01001000 01100101 01101100 01101100 01101111 01110111 00100001

Discussion in 'Off Topic' started by coder7, Nov 24, 2006.

  1. coder7

    coder7 New Member

    Messages:
    0
    Likes Received:
    0
    Trophy Points:
    0
    01001000 01100101 01101100 01101100 01101111 01110111 00100001

    I am new to this... but, hey all!
     
  2. Micro

    Micro Retired staff <i> (11-12-2008)</I>

    Messages:
    1,301
    Likes Received:
    0
    Trophy Points:
    36
    01001000 01100101 01101100 01101100 01101111 00100001 00100000 01010111 01100101 01101100
    01100011 01101111 01101101 01100101 00100000 01110100 01101111 00100000 01111000 00110001
    00110000 00100001

    Hello! Welcome to x10!
    :D
     
  3. lambada

    lambada New Member

    Messages:
    2,444
    Likes Received:
    0
    Trophy Points:
    0
    01001010 01110101 01110011 01110100 00100000 01110010 01100101 01101101 01100101 01101101 01100010 01100101 01110010 00100000 01110100 01101000 01100001 01110100 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00100000 01101001 01110011 00100000 01101110 01101111 01110100 00100000 01100001 00100000 01110011 01110101 01110000 01110000 01101111 01110010 01110100 01100101 01100100 00100000 01101100 01100001 01101110 01100111 01110101 01100001 01100111 01100101 00100000 01100110 01101111 01110010 00100000 01111001 01101111 01110101 01110010 00100000 01110111 01100101 01100010 01110011 01101001 01110100 01100101 00100000 01111001 01101111 01110101 00100000 01101110 01100101 01100101 01100100 00100000 01101001 01110100 00100000 01101001 01101110 00100000 01000101 01101110 01100111 01101100 01101001 01110011 01101000 00101100 00100000 01000110 01110010 01100101 01101110 01100011 01101000 00100000 01101111 01110010 00100000 01010011 01110000 01100001 01101110 01101001 01110011 01101000 00100000 00111010 01010000
     
  4. Derek

    Derek Community Support Force Community Support

    Messages:
    12,883
    Likes Received:
    186
    Trophy Points:
    63
    01001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 00100001

    hello welcom to x10hosting.com hope you have a good time here if you got any questions feel free to pm me
     
  5. Alexis

    Alexis New Member

    Messages:
    25
    Likes Received:
    0
    Trophy Points:
    0
    why are u writting in binary?

    01110111 01101000 01111001 00100000 01100001 01110010 01100101 00100000 01110101 00100000 01110111 01110010 01101001 01110100 01110100 01101001 01101110 01100111 00100000 01101001 01101110 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00111111
     
    Last edited: Nov 24, 2006
  6. benjamin

    benjamin New Member

    Messages:
    4
    Likes Received:
    0
    Trophy Points:
    0
  7. the_king_dollars

    the_king_dollars New Member

    Messages:
    153
    Likes Received:
    0
    Trophy Points:
    0
  8. swirly

    swirly Active Member

    Messages:
    1,930
    Likes Received:
    0
    Trophy Points:
    36
    01101001 00100000 01101000 01100001 01110100 01100101 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00101110 00101110 00101110 01100010 01110101 01110100 00100000 01110111 01100101 01101100 01100011 01101111 01101101 01100101 00100000 01110100 01101111 00100000 01110100 01101000 01100101 00100000 01100110 01101111 01110010 01110101 01101101 01110011 00100001 00100000 01101100 01100101 01110100 00100000 01101101 01100101 00100000 01101011 01101110 01101111 01110111 00100000 01101001 01100110 00100000 01111001 01101111 01110101 00100000 01101110 01100101 01100101 01100100 00100000 01100001 01101110 01111001 00100000 01101000 01100101 01101100 01110000 00100001
     
  9. t2t2t

    t2t2t New Member

    Messages:
    690
    Likes Received:
    0
    Trophy Points:
    0
    000000000000000000000000000000000
    010001011111010000010000001110010
    010001010000010000010000010001010
    011111011100010000010000010001010
    010001010000010000010000010001000
    010001011111011111011111001110010
    000000000000000000000000000000000
     
  10. powersports

    powersports New Member

    Messages:
    49
    Likes Received:
    0
    Trophy Points:
    0
    Hey, new person...

    Welcome

    and

    What does that code do/stand for? It doesn't seem to be in a simple BCD format or HEX format like I sorta know? What is it?

    TTYL
     
  11. noerrorsfound

    noerrorsfound New Member

    Messages:
    1,736
    Likes Received:
    1
    Trophy Points:
    0
    I'm not the thread creator, but wanted to answer your question.

    It's binary, except for post #9.

    Helpful Google searches:
    binary converter
    binary translator
     
    Last edited: Dec 5, 2006
  12. Ferinos

    Ferinos New Member

    Messages:
    69
    Likes Received:
    0
    Trophy Points:
    0
    Bonjour, hello, Hola, gfuten tag order guten nacht, hiya au reviour.
     
  13. Cubeform

    Cubeform New Member

    Messages:
    339
    Likes Received:
    0
    Trophy Points:
    0
    Pfft... screw binary. Hex is what the cool kids use:

    416C 736F 2C20 5745 4C43 4F4D 4520 746F 2078 3130 686F 7374 696E 6721
     
  14. lambada

    lambada New Member

    Messages:
    2,444
    Likes Received:
    0
    Trophy Points:
    0
    I disagree - Everything ends up as binary in a computer.

    A little challenge - someone tell me what language this is
    ATCGCGCGCGCATATATATATCGCGATATATCGCG
    100 points to the first correct reply!
     
  15. Brandon

    Brandon Former Senior Account Rep Community Support

    Messages:
    19,181
    Likes Received:
    28
    Trophy Points:
    48
    Haha lambada, nobody can get that one....;)
     
  16. DaTaX

    DaTaX New Member

    Messages:
    44
    Likes Received:
    0
    Trophy Points:
    0
    That's DNA (at least its a string of the four kinds of bases that are found in DNA...). And by the way, I don't think there is a cooler coding language...

    Now, here's to our new friend:

    01010111 01100101 01101100 01100011 01101111 01101101 01100101 00100000 01110100 01101111 00100000 01111000 00110001 00110000 00100000 01101000 01101111 01110011 01110100 01101001 01101110 01100111 00100001
     
  17. noerrorsfound

    noerrorsfound New Member

    Messages:
    1,736
    Likes Received:
    1
    Trophy Points:
    0
    I'm not sure if you were talking about Cubeform's post or mine, but yes, his post is still "technically" binary. Although, if you wish to be that ____ (sorry, I couldn't remember the correct word to use) then the language you posted is also binary, and you now owe me 100 points for my correct answer. :p Actually, that's only if DaTaX didn't give the correct answer.
     
    Last edited: Dec 6, 2006
  18. Brandon

    Brandon Former Senior Account Rep Community Support

    Messages:
    19,181
    Likes Received:
    28
    Trophy Points:
    48
    It is DNA coding;)
     
  19. lambada

    lambada New Member

    Messages:
    2,444
    Likes Received:
    0
    Trophy Points:
    0
    Congrats DaTaX - 100 of my precious points are on their way. noerrors found can get 50 points for being technically right seeing as you are reading this on a computer based device :p
     
    Last edited: Dec 7, 2006

Share This Page